代写HIM3002、代做Python编程语言

日期：2025-04-05 07:53

Tung Wah College

HIM3002: Computer Programming for Healthcare

Individual assignment: Finding Patterns in Sequence

Background

In Lecture 6, we learned the programming techniques in finding patterns in biological sequence,

specifically finding fixed pattern and flexible pattern. In this tutorial exercise, you will have

further practices in finding patterns in sequences. Name your file “T06_PatternAnalyser.py”.

Task 1

Write a function that takes a sequence and an integer k as inputs. It returns True if the input

sequence has repeated sub-sequence of size k, and False otherwise. Your function should be

similar to that below.

def repeated_subseq(seq, k):

"""Return True if the sequence seq has repeated sub-sequence with size

k and False otherwise"""

# To be completed

print(repeated_subseq("ACGTAGAGGCGTATTAGCGT", 3))

print(repeated_subseq("ACGTAGAGGCGTATTAGCGT", 5))

The output is

True

False

Task 2

By making use of the function “re_all_match”, find the following patterns in the sequence.

a) A DNA pattern with four symbols, with “A” and “T” at the first and the last symbol,

e.g., “AGGT”, “ACTT”.

b) A DNA pattern with at least two symbols, with “A” and “T” at the first and the last

symbol, e.g., “AT”, “ACT”, “AGGGT”.

c) A DNA pattern with at least three symbols, with symbols “A” and “T” at the beginning

and at the end, and any symbols except “C” in between, e.g., “AGAT”, “AAGT”,

“AATGT” but not “ACGT”, assuming only “A”, “G”, “C” and “T” are in the sequence.

d) A protein pattern with 10 and 15 symbols, with “M” at the beginning and “D” at the

end.

For example,

a) Sequence: AGGTAGTTTGACGTTACTG

Found pattern: AGGT located at 0

Found pattern: AGTT located at 4

Found pattern: ACGT located at 10

b) Sequence: AGGTGCAAGTGACGAACAAG

Found pattern: AGGTGCAAGT located at 0

Found pattern: AAGT located at 6

Found pattern: AGT located at 7

c) Sequence: AGGTGCAAGTGACGAACAAG

Found pattern: AGGT located at 0

Found pattern: AAGT located at 6

Found pattern: AGT located at 7

d) Sequence:

CDEMECMEDDFEMECMEDDFEMECMEDDFEMECMEDDFEGHIEJMCEE

Found pattern: MECMEDDFEMECMED located at 3

Found pattern: MEDDFEMECMEDD located at 6

Found pattern: MECMEDDFEMECMED located at 12

Found pattern: MEDDFEMECMEDD located at 15

Found pattern: MECMEDDFEMECMED located at 21

Found pattern: MEDDFEMECMEDD located at 24

2